Chst10 antibody thermo
WebThere are currently no images for Carbohydrate Sulfotransferase 10/CHST10 Antibody (NBP2-97238R). Every product we sell is backed by Novus' 100% Guarantee . If you … WebCompare Anti-CHST10 Immunohistochemistry Antibody Products from leading suppliers on Biocompare. View specifications, prices, citations, reviews, and more.
Chst10 antibody thermo
Did you know?
WebCHST10 (HNK-1ST) protein expression summary. We use cookies to enhance the usability of our website. If you continue, we'll assume that you are happy to receive all cookies. ... Antibody specificity analysis with protein arrays. Predicted and matching interactions are shown in green. Antibody dilution: 1:3000: 1:500: ANTIGEN INFORMATION; WebA superior strategy for validation of antibody: Blocking peptide validation; Independent Antibody Verification; phospho-antibody made by Affinity; Fruit fly studies guide investigators to misregulated mechanism in human cancers; G Protein-Coupled Receptors (GPCRs) win 2012 Nobel Prize in Chemistry
WebHNK-1ST/CHST10 antibodies are validated with different applications, which are IHC-P. HNK-1ST/CHST10 cDNA Clone (13) HNK-1ST/CHST10 cDNA clones are full length sequence confirmed and expression validated. There are 13 kinds of tags for each HNK-1ST/CHST10 of different species, especially GFP tag, OFP tag, FLAG tag and so on. … WebView Rabbit Polyclonal anti-Carbohydrate Sulfotransferase 10/CHST10 Antibody [DyLight 488] (NBP2-97238G). Validated Applications: IHC, IHC-P. Validated Species: Human.
WebRabbit Polyclonal CHST10 antibody Internal Region for ELISA, ICC, IF, IHC, WB. Order anti-CHST10 antibody ABIN6258961. language English local_shipping United States phone+1 877 302 8632; Contact; person Login favorite_border Comparison List shopping_cart Basket menu; north; arrow_back. search. search. Phone: +1 877 302 … WebThermo Fisher Scientific's CHST10 Antibody is a Rabbit Polyclonal antibody. This antibody has been shown to work in applications such as: Immunohistochemistry, …
WebAnti-CHST10 Antibody Products from Thermo Fisher Scientific Anti-CHST10 antibodies are offered by a number of suppliers. This target gene encodes the protein 'carbohydrate …
WebCHST10 Polyclonal Antibody Product Details Size 100 µL Species Reactivity Human, Mouse, Rat Host / Isotype Rabbit / IgG Class Polyclonal Type Antibody Conjugate … black and hay estate agentsWebWe offer a wide range of validated CHST10 antibodies. Order online or by email, fax, or phone. ️ Low Prices ️ 100% Guarantee ️ FREE Shipping black and hawks 2014WebFawn Creek Township is a locality in Kansas. Fawn Creek Township is situated nearby to the village Dearing and the hamlet Jefferson. Map. Directions. Satellite. Photo Map. black and hay solicitors prestwickWebCHST10, Rabbit, Monoclonal Antibody, Abnova™-Rabbit monoclonal antibody raised against a human CHST10 peptide using ARM Technology. Fisher Scientific Fisher Healthcare black and heald funeral home maineWebFeb 2, 2013 · A Chst10 targeting vector was constructed as shown in Fig. 1. Homologously recombined ES clones were selected by Southern hybridization using a probe adjacent to the targeting vector. Probe DNA (about 450 bp) was amplified by PCR using the following primers: 5–12s, TGTAGTCAAGGCAGCAACCAAGCA, and 5–13a, … black and heald funeral homeWebAnti-CHST10 Antibody Products from Thermo Fisher Scientific. Anti-CHST10 antibodies are offered by a number of suppliers. This target gene encodes the protein 'carbohydrate sulfotransferase 10' in humans and may also be known as HNK1ST, HNK-1ST, HNK-1 sulfotransferase, and huHNK-1ST. Structurally, the protein is reported to be 42.2 … black and hay solicitors ayrWebImmunohistochemical analysis of paraffin-embedded human gliomas using 12013-1-AP (CHST10 antibody) at dilution of 1:50 (under 10x lens). View All Images (2) Save time and replace your secondary antibodies with our FlexAble Antibody Labeling Kits $389 / 150 μL Cat No. 12013-1-AP In stock. black and hay houses for sale